Transcript: Mouse XM_006534577.4

PREDICTED: Mus musculus tripartite motif-containing 7 (Trim7), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Trim7 (94089)
Length:
2622
CDS:
307..1419

Additional Resources:

NCBI RefSeq record:
XM_006534577.4
NBCI Gene record:
Trim7 (94089)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006534577.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436975 GGGCAATGCAACTCAACAATG pLKO_005 1181 CDS 100% 10.800 15.120 N Trim7 n/a
2 TRCN0000423120 TAACCATCCTCGCCGCTTTGA pLKO_005 1005 CDS 100% 4.950 6.930 N Trim7 n/a
3 TRCN0000426213 CCCTCAAGAGTTTCGTCTTAA pLKO_005 827 CDS 100% 13.200 9.240 N Trim7 n/a
4 TRCN0000039475 GCCTTGAAGAAGGTACTGGAA pLKO.1 184 5UTR 100% 2.640 1.848 N Trim7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006534577.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.