Transcript: Mouse XM_006534900.3

PREDICTED: Mus musculus RNA polymerase II associated protein 2 (Rpap2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rpap2 (231571)
Length:
2215
CDS:
230..1843

Additional Resources:

NCBI RefSeq record:
XM_006534900.3
NBCI Gene record:
Rpap2 (231571)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006534900.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339623 AGATTACAATGGGAGATATTT pLKO_005 1578 CDS 100% 15.000 10.500 N Rpap2 n/a
2 TRCN0000339698 ACTTGATGAAGATGACATAAG pLKO_005 1219 CDS 100% 10.800 7.560 N Rpap2 n/a
3 TRCN0000176077 GCAAGAAGGAAGCTCTTACAT pLKO.1 1981 3UTR 100% 5.625 3.938 N Rpap2 n/a
4 TRCN0000194386 CCCTGCTGACAGAATTGCATT pLKO.1 1770 CDS 100% 4.950 3.465 N Rpap2 n/a
5 TRCN0000339621 CCCTGCTGACAGAATTGCATT pLKO_005 1770 CDS 100% 4.950 3.465 N Rpap2 n/a
6 TRCN0000174992 GACTGATGACTAAGTGTGTAA pLKO.1 1929 3UTR 100% 4.950 3.465 N Rpap2 n/a
7 TRCN0000339695 GACTGATGACTAAGTGTGTAA pLKO_005 1929 3UTR 100% 4.950 3.465 N Rpap2 n/a
8 TRCN0000176267 CCTTTGTGTCAGAAGAAGCTA pLKO.1 305 CDS 100% 3.000 2.100 N Rpap2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006534900.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.