Transcript: Mouse XM_006534936.3

PREDICTED: Mus musculus RIKEN cDNA 2900026A02 gene (2900026A02Rik), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
2900026A02Rik (243219)
Length:
10742
CDS:
733..6036

Additional Resources:

NCBI RefSeq record:
XM_006534936.3
NBCI Gene record:
2900026A02Rik (243219)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006534936.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264703 GATGTCACCACACCCATAAAC pLKO_005 6045 3UTR 100% 13.200 18.480 N 2900026A02Rik n/a
2 TRCN0000264702 CAGTCACTTGTCCTCATATAC pLKO_005 5343 CDS 100% 13.200 9.240 N 2900026A02Rik n/a
3 TRCN0000264701 CCCTGCCCAGGAAGATGATTT pLKO_005 5487 CDS 100% 13.200 9.240 N 2900026A02Rik n/a
4 TRCN0000178032 GCAGTCACTTGTCCTCATATA pLKO.1 5342 CDS 100% 13.200 9.240 N 2900026A02Rik n/a
5 TRCN0000181514 GCAGAGCCTGTATGAGAATCA pLKO.1 6009 CDS 100% 4.950 3.465 N 2900026A02Rik n/a
6 TRCN0000264699 AGTCACACAGCACGTGGATGT pLKO_005 5660 CDS 100% 4.050 2.835 N 2900026A02Rik n/a
7 TRCN0000181905 GATGTTCAAGGACTCCACAGA pLKO.1 5676 CDS 100% 2.640 1.848 N 2900026A02Rik n/a
8 TRCN0000264700 GGCAGAGCCTGTATGAGAATC pLKO_005 6008 CDS 100% 10.800 6.480 N 2900026A02Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006534936.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.