Transcript: Mouse XM_006534942.3

PREDICTED: Mus musculus kelch-like 8 (Klhl8), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Klhl8 (246293)
Length:
3176
CDS:
296..2185

Additional Resources:

NCBI RefSeq record:
XM_006534942.3
NBCI Gene record:
Klhl8 (246293)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006534942.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257530 AGCGAGCTTCACGGTTGTTTA pLKO_005 1829 CDS 100% 13.200 18.480 N Klhl8 n/a
2 TRCN0000217549 CACAACCGAATAGACCTAATG pLKO.1 857 CDS 100% 10.800 15.120 N Klhl8 n/a
3 TRCN0000246346 TGCTGTATGCAGCGTGTATTC pLKO_005 741 CDS 100% 10.800 15.120 N Klhl8 n/a
4 TRCN0000246349 ACATTCTTGAAACCATATTAG pLKO_005 2698 3UTR 100% 13.200 9.240 N Klhl8 n/a
5 TRCN0000246347 ATCCGCAACATCATCCTAAAT pLKO_005 1044 CDS 100% 13.200 9.240 N Klhl8 n/a
6 TRCN0000246348 TGAAGCCAAGCAGGCGTTAAT pLKO_005 625 CDS 100% 13.200 9.240 N Klhl8 n/a
7 TRCN0000192125 CCTCAACATTGACAGTGAGAA pLKO.1 985 CDS 100% 4.950 3.465 N Klhl8 n/a
8 TRCN0000191358 CTCATCAACATGAGAACTTAA pLKO.1 2551 3UTR 100% 1.320 0.924 N Klhl8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006534942.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.