Transcript: Mouse XM_006534956.3

PREDICTED: Mus musculus nucleoporin 54 (Nup54), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nup54 (269113)
Length:
2552
CDS:
193..1887

Additional Resources:

NCBI RefSeq record:
XM_006534956.3
NBCI Gene record:
Nup54 (269113)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006534956.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313035 AGAGGTTACTGTACGTTAAAT pLKO_005 2011 3UTR 100% 15.000 21.000 N Nup54 n/a
2 TRCN0000102206 GCCACTTGATTAGCATCATAA pLKO.1 1787 CDS 100% 13.200 18.480 N Nup54 n/a
3 TRCN0000312987 CGCAGGTGTTGATCCTATTAT pLKO_005 1266 CDS 100% 15.000 12.000 N Nup54 n/a
4 TRCN0000102207 CCGCAGGTGTTGATCCTATTA pLKO.1 1265 CDS 100% 13.200 10.560 N Nup54 n/a
5 TRCN0000349856 CAGACGGAAGTTGTCATTTAT pLKO_005 1072 CDS 100% 15.000 10.500 N Nup54 n/a
6 TRCN0000313033 TATAGTTGTATGCCCAATAAT pLKO_005 895 CDS 100% 15.000 10.500 N Nup54 n/a
7 TRCN0000102209 CGGGTTCAGCTAGATACTATT pLKO.1 1594 CDS 100% 13.200 9.240 N Nup54 n/a
8 TRCN0000312091 CGGGTTCAGCTAGATACTATT pLKO_005 1594 CDS 100% 13.200 9.240 N Nup54 n/a
9 TRCN0000102205 GCTGTGCTTCAGGGTATAAAT pLKO.1 2268 3UTR 100% 15.000 9.000 N Nup54 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006534956.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12022 pDONR223 100% 76.8% 84% None (many diffs) n/a
2 ccsbBroad304_12022 pLX_304 0% 76.8% 84% V5 (many diffs) n/a
Download CSV