Transcript: Mouse XM_006535030.1

PREDICTED: Mus musculus expressed sequence C87414 (C87414), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
C87414 (381654)
Length:
2639
CDS:
223..1650

Additional Resources:

NCBI RefSeq record:
XM_006535030.1
NBCI Gene record:
C87414 (381654)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006535030.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000367172 GAGAATAGGATCCCTATATTT pLKO_005 720 CDS 100% 15.000 7.500 Y C87414 n/a
2 TRCN0000269611 CAAGATGAATGTGGAACAATA pLKO_005 1431 CDS 100% 13.200 6.600 Y E330014E10Rik n/a
3 TRCN0000367174 CATGGGTCTTTGACTATTAAC pLKO_005 1943 3UTR 100% 13.200 6.600 Y C87414 n/a
4 TRCN0000216046 CTTATATGCTTTGGATCTTAT pLKO.1 1209 CDS 100% 13.200 6.600 Y AA792892 n/a
5 TRCN0000246844 CTTATATGCTTTGGATCTTAT pLKO_005 1209 CDS 100% 13.200 6.600 Y AA792892 n/a
6 TRCN0000367173 GTGAAGGTCCTTCCGAGATAT pLKO_005 607 CDS 100% 13.200 6.600 Y C87414 n/a
7 TRCN0000367107 CTTCATGAAACACGTCCATTT pLKO_005 1032 CDS 100% 10.800 5.400 Y C87414 n/a
8 TRCN0000367175 GACCCACCAGACCAAGTTATC pLKO_005 766 CDS 100% 10.800 5.400 Y C87414 n/a
9 TRCN0000376273 TCTATGACCAGGGCCCAATAC pLKO_005 1610 CDS 100% 10.800 5.400 Y C87414 n/a
10 TRCN0000376335 TGAAGGACTCCCAGATCAATG pLKO_005 1298 CDS 100% 10.800 5.400 Y C87414 n/a
11 TRCN0000376272 TTATATGCTTTGGATCTTATG pLKO_005 1210 CDS 100% 10.800 5.400 Y C87414 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006535030.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.