Transcript: Mouse XM_006535384.2

PREDICTED: Mus musculus cytochrome P450, family 7, subfamily b, polypeptide 1 (Cyp7b1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cyp7b1 (13123)
Length:
2261
CDS:
401..1459

Additional Resources:

NCBI RefSeq record:
XM_006535384.2
NBCI Gene record:
Cyp7b1 (13123)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006535384.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000182866 CTCGTGAACCACCCTTGATAA pLKO.1 522 CDS 100% 13.200 18.480 N Cyp7b1 n/a
2 TRCN0000198018 CCCATACTTAGTATCTGACAT pLKO.1 1063 CDS 100% 4.950 3.465 N Cyp7b1 n/a
3 TRCN0000200240 CTTTGCAGAGTAAGGCTGCAT pLKO.1 1765 3UTR 100% 0.264 0.185 N Cyp7b1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006535384.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.