Transcript: Mouse XM_006535502.3

PREDICTED: Mus musculus coiled-coil domain containing 39 (Ccdc39), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ccdc39 (51938)
Length:
1761
CDS:
130..1662

Additional Resources:

NCBI RefSeq record:
XM_006535502.3
NBCI Gene record:
Ccdc39 (51938)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006535502.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000200052 CGAGTCAAGAATGAGACCCAA pLKO.1 415 CDS 100% 2.640 3.696 N Ccdc39 n/a
2 TRCN0000433409 GAACGCAGAATGTCACGATTA pLKO_005 1513 CDS 100% 10.800 8.640 N Ccdc39 n/a
3 TRCN0000435634 TGACTATGAAGAACGAATTAA pLKO_005 267 CDS 100% 15.000 10.500 N Ccdc39 n/a
4 TRCN0000430257 AGACGCTAAGTGCGCAGTTAG pLKO_005 722 CDS 100% 10.800 7.560 N Ccdc39 n/a
5 TRCN0000176503 CCTTGAACTTAAGAAGACAAT pLKO.1 1581 CDS 100% 4.950 3.465 N Ccdc39 n/a
6 TRCN0000176967 GAGAAGATCAAGTTTCTGGAA pLKO.1 919 CDS 100% 2.640 1.848 N Ccdc39 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006535502.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.