Transcript: Mouse XM_006535674.3

PREDICTED: Mus musculus ArfGAP with GTPase domain, ankyrin repeat and PH domain 3 (Agap3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Agap3 (213990)
Length:
4091
CDS:
504..3647

Additional Resources:

NCBI RefSeq record:
XM_006535674.3
NBCI Gene record:
Agap3 (213990)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006535674.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424913 CGATATCTGACAGGGACTTAT pLKO_005 1485 CDS 100% 13.200 18.480 N Agap3 n/a
2 TRCN0000446747 GACAACGGGTTGCTTACTTAC pLKO_005 2340 CDS 100% 10.800 15.120 N Agap3 n/a
3 TRCN0000106172 GCAACCTGTCTAGTGGGAAAT pLKO.1 1450 CDS 100% 10.800 15.120 N Agap3 n/a
4 TRCN0000415823 TTGGCAATGGAGCGGAGTAAC pLKO_005 2502 CDS 100% 10.800 15.120 N Agap3 n/a
5 TRCN0000429939 GAGCTTAAAGTGGGCATAGTG pLKO_005 1428 CDS 100% 4.950 3.960 N AGAP3 n/a
6 TRCN0000106171 CCAGAGCTTAAAGTGGGCATA pLKO.1 1425 CDS 100% 4.050 3.240 N Agap3 n/a
7 TRCN0000106173 CCTACTATGAAACATGCGCAA pLKO.1 1834 CDS 100% 2.160 1.728 N Agap3 n/a
8 TRCN0000444944 GTTCAGCCTGGAGGATGAAAT pLKO_005 1646 CDS 100% 13.200 9.240 N Agap3 n/a
9 TRCN0000425500 AGCAGAAGAGCGGGAACTATG pLKO_005 2786 CDS 100% 10.800 7.560 N Agap3 n/a
10 TRCN0000437261 GCTCTGGATGGTTACTCTAAG pLKO_005 3144 CDS 100% 10.800 7.560 N Agap3 n/a
11 TRCN0000106170 CCATTAAAGGATAGAACCCTT pLKO.1 3814 3UTR 100% 2.640 1.848 N Agap3 n/a
12 TRCN0000106174 CCTTTGAGTTTGTAGTGGTGT pLKO.1 2728 CDS 100% 2.640 1.848 N Agap3 n/a
13 TRCN0000047999 GCAGACATCTTGATCCAGCAT pLKO.1 3522 CDS 100% 2.640 1.848 N AGAP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006535674.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.