Transcript: Mouse XM_006535775.3

PREDICTED: Mus musculus ring finger protein 32 (Rnf32), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rnf32 (56874)
Length:
4320
CDS:
870..1976

Additional Resources:

NCBI RefSeq record:
XM_006535775.3
NBCI Gene record:
Rnf32 (56874)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006535775.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000226361 CCGCCTTCGGATGCCAAATTA pLKO_005 1515 CDS 100% 15.000 21.000 N Rnf32 n/a
2 TRCN0000226360 GCCTTACAGGACCACCTATTA pLKO_005 927 CDS 100% 13.200 18.480 N Rnf32 n/a
3 TRCN0000226363 TGATGTCTGCTTGGCGGTAAA pLKO_005 1628 CDS 100% 10.800 15.120 N Rnf32 n/a
4 TRCN0000226362 GCTCATACAACACCAACATAG pLKO_005 1588 CDS 100% 10.800 8.640 N Rnf32 n/a
5 TRCN0000039413 CGTTAGAAAGTGGTACAGAAA pLKO.1 1478 CDS 100% 4.950 3.960 N Rnf32 n/a
6 TRCN0000217982 ACACCACCACCATTAACTTTA pLKO_005 1128 CDS 100% 13.200 9.240 N Rnf32 n/a
7 TRCN0000039411 CCTCTGTAGAAAGAACCAATA pLKO.1 1373 CDS 100% 10.800 7.560 N Rnf32 n/a
8 TRCN0000039410 GCCCAATATGTAAAGAAGAAT pLKO.1 1255 CDS 100% 5.625 3.938 N Rnf32 n/a
9 TRCN0000039409 AGGAAGTTAAATGTCTGACTA pLKO.1 1987 3UTR 100% 4.950 3.465 N Rnf32 n/a
10 TRCN0000039412 CCTGTGCTCATACAACACCAA pLKO.1 1583 CDS 100% 2.640 1.848 N Rnf32 n/a
11 TRCN0000034106 TGCTCATACAACACCAACATT pLKO.1 1587 CDS 100% 5.625 3.938 N RNF32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006535775.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.