Transcript: Mouse XM_006535856.3

PREDICTED: Mus musculus vesicle-associated membrane protein 7 (Vamp7), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Vamp7 (20955)
Length:
2525
CDS:
431..790

Additional Resources:

NCBI RefSeq record:
XM_006535856.3
NBCI Gene record:
Vamp7 (20955)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006535856.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336077 TTACGGTTCAAGAGCACAAAC pLKO_005 394 5UTR 100% 10.800 15.120 N Vamp7 n/a
2 TRCN0000380733 TAAGAGCCTAGACAAAGTGAT pLKO_005 487 CDS 100% 4.950 6.930 N Vamp7 n/a
3 TRCN0000115067 GCACTTCCTTATGCTATGAAT pLKO.1 416 5UTR 100% 5.625 4.500 N Vamp7 n/a
4 TRCN0000353419 GCACTTCCTTATGCTATGAAT pLKO_005 416 5UTR 100% 5.625 4.500 N Vamp7 n/a
5 TRCN0000115068 CTTACTCACATGGCAATTATT pLKO.1 258 5UTR 100% 15.000 10.500 N Vamp7 n/a
6 TRCN0000353291 CTTTGCCTGTCATATAGTTTG pLKO_005 928 3UTR 100% 10.800 7.560 N Vamp7 n/a
7 TRCN0000336014 TTTGTATCACTGATGATGATT pLKO_005 315 5UTR 100% 5.625 3.938 N Vamp7 n/a
8 TRCN0000115070 GCACAAGTGGATGAACTGAAA pLKO.1 518 CDS 100% 4.950 3.465 N Vamp7 n/a
9 TRCN0000336075 GCACAAGTGGATGAACTGAAA pLKO_005 518 CDS 100% 4.950 3.465 N Vamp7 n/a
10 TRCN0000115069 TCGAGCCATGTGTATGAAGAA pLKO.1 664 CDS 100% 4.950 3.465 N Vamp7 n/a
11 TRCN0000380436 GCACAACTGAAGCATCACTCT pLKO_005 461 CDS 100% 2.640 1.848 N Vamp7 n/a
12 TRCN0000293927 TTGTATCACTGATGATGATTT pLKO_005 316 5UTR 100% 13.200 7.920 N VAMP7 n/a
13 TRCN0000059890 GAGCAGATTCTGGCTAAGATA pLKO.1 215 5UTR 100% 5.625 3.375 N VAMP7 n/a
14 TRCN0000115066 CCTGTCATATAGTTTGTGTTA pLKO.1 933 3UTR 100% 4.950 2.970 N Vamp7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006535856.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.