Transcript: Mouse XM_006536155.3

PREDICTED: Mus musculus adaptor-related protein complex 2, alpha 2 subunit (Ap2a2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ap2a2 (11772)
Length:
4054
CDS:
778..2412

Additional Resources:

NCBI RefSeq record:
XM_006536155.3
NBCI Gene record:
Ap2a2 (11772)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006536155.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238175 TTAGGCCGAATGTTCATATTT pLKO_005 1795 CDS 100% 15.000 12.000 N Ap2a2 n/a
2 TRCN0000257339 CTATGCTGCCAAGACGGTATT pLKO_005 1023 CDS 100% 10.800 7.560 N Ap2a2 n/a
3 TRCN0000238172 TCCTATCCCTATGGTACATTC pLKO_005 3073 3UTR 100% 10.800 7.560 N Ap2a2 n/a
4 TRCN0000238174 TGCAACAAGTGGTCAACATTG pLKO_005 1943 CDS 100% 10.800 7.560 N Ap2a2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006536155.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05788 pDONR223 99.7% 50% 55.4% None (many diffs) n/a
2 ccsbBroad304_05788 pLX_304 0% 50% 55.4% V5 (many diffs) n/a
3 TRCN0000491951 GGGGGTACAACGGGGGCATTATCG pLX_317 3.8% 50% 55.4% V5 (many diffs) n/a
Download CSV