Transcript: Mouse XM_006536224.3

PREDICTED: Mus musculus tetraspanin 4 (Tspan4), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tspan4 (64540)
Length:
1631
CDS:
342..1157

Additional Resources:

NCBI RefSeq record:
XM_006536224.3
NBCI Gene record:
Tspan4 (64540)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006536224.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094945 CAGGGAAACTTTGCCACCTTA pLKO.1 552 CDS 100% 4.950 3.465 N Tspan4 n/a
2 TRCN0000094947 CAGTGACAAGATTGACAGTTA pLKO.1 761 CDS 100% 4.950 3.465 N Tspan4 n/a
3 TRCN0000326840 CAGTGACAAGATTGACAGTTA pLKO_005 761 CDS 100% 4.950 3.465 N Tspan4 n/a
4 TRCN0000094944 CCCAGGGAACTTTGACACTTT pLKO.1 1375 3UTR 100% 4.950 3.465 N Tspan4 n/a
5 TRCN0000326839 CCCAGGGAACTTTGACACTTT pLKO_005 1375 3UTR 100% 4.950 3.465 N Tspan4 n/a
6 TRCN0000094946 GTGGGTTACATGAACCTGGTA pLKO.1 970 CDS 100% 2.640 1.848 N Tspan4 n/a
7 TRCN0000326838 GTGGGTTACATGAACCTGGTA pLKO_005 970 CDS 100% 2.640 1.848 N Tspan4 n/a
8 TRCN0000094948 GTACCTCATGTTCGCCTTCAA pLKO.1 470 CDS 100% 0.000 0.000 N Tspan4 n/a
9 TRCN0000326830 GTACCTCATGTTCGCCTTCAA pLKO_005 470 CDS 100% 0.000 0.000 N Tspan4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006536224.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07079 pDONR223 100% 76.7% 82.2% None (many diffs) n/a
Download CSV