Transcript: Mouse XM_006537480.2

PREDICTED: Mus musculus major urinary protein 9 (Mup9), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mup9 (100038948)
Length:
932
CDS:
76..783

Additional Resources:

NCBI RefSeq record:
XM_006537480.2
NBCI Gene record:
Mup9 (100038948)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006537480.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000284164 ATGAAGAGTGCTCCGAATTAT pLKO_005 311 CDS 100% 15.000 7.500 Y Mup10 n/a
2 TRCN0000270002 TCTACGGGAAGGAACTTTAAT pLKO_005 142 CDS 100% 15.000 7.500 Y Mup10 n/a
3 TRCN0000272266 ACCTAAGACAGACTATGATAA pLKO_005 405 CDS 100% 13.200 6.600 Y Mup7 n/a
4 TRCN0000284694 CTATGGCCGAGAACCAGATTT pLKO_005 486 CDS 100% 13.200 6.600 Y Mup7 n/a
5 TRCN0000272111 CTTATGGCTCATCTCATTAAC pLKO_005 430 CDS 100% 13.200 6.600 Y Mup13 n/a
6 TRCN0000272265 GATGAAGAGTGCTCCGAATTA pLKO_005 310 CDS 100% 13.200 6.600 Y Mup7 n/a
7 TRCN0000281883 GTTCTACGGGAAGGAACTTTA pLKO_005 140 CDS 100% 13.200 6.600 Y Mup7 n/a
8 TRCN0000284161 TAGAAGATAATGGCAACTTTA pLKO_005 224 CDS 100% 13.200 6.600 Y Mup10 n/a
9 TRCN0000270001 TCTTATGGCTCATCTCATTAA pLKO_005 429 CDS 100% 13.200 6.600 Y Mup10 n/a
10 TRCN0000105448 TGACGTATGATGGATTCAATA pLKO.1 374 CDS 100% 13.200 6.600 Y Mup1 n/a
11 TRCN0000272237 TGATGGATTCAATACATTTAC pLKO_005 381 CDS 100% 13.200 6.600 Y Mup7 n/a
12 TRCN0000272050 TTCTACGGGAAGGAACTTTAA pLKO_005 141 CDS 100% 13.200 6.600 Y Mup13 n/a
13 TRCN0000272267 AGAAGATAATGGCAACTTTAG pLKO_005 225 CDS 100% 10.800 5.400 Y Mup8 n/a
14 TRCN0000272239 CCTAAGACAGACTATGATAAC pLKO_005 406 CDS 100% 10.800 5.400 Y Mup8 n/a
15 TRCN0000272291 CTATACCTAAGACAGACTATG pLKO_005 401 CDS 100% 10.800 5.400 Y Mup9 n/a
16 TRCN0000297085 GACGTATGATGGATTCAATAC pLKO_005 375 CDS 100% 10.800 5.400 Y Mup13 n/a
17 TRCN0000270003 GTCTCACTGAGAAGTCCAATT pLKO_005 774 CDS 100% 10.800 5.400 Y Mup10 n/a
18 TRCN0000272268 TATGGCCGAGAACCAGATTTG pLKO_005 487 CDS 100% 10.800 5.400 Y Mup8 n/a
19 TRCN0000272270 GTGAATATTCTGTGACGTATG pLKO_005 362 CDS 100% 6.000 3.000 Y Mup8 n/a
20 TRCN0000105447 CGTATGATGGATTCAATACAT pLKO.1 377 CDS 100% 5.625 2.813 Y Mup1 n/a
21 TRCN0000272290 GAATATTCTGTGACGTATGAT pLKO_005 364 CDS 100% 5.625 2.813 Y Mup9 n/a
22 TRCN0000272250 CCATGCAGAAGAAGCTAGTTC pLKO_005 123 CDS 100% 4.950 2.475 Y Mup9 n/a
23 TRCN0000105449 GATAGAAGATAATGGCAACTT pLKO.1 222 CDS 100% 4.950 2.475 Y Mup1 n/a
24 TRCN0000105446 GCCGAGAACCAGATTTGAGTT pLKO.1 491 CDS 100% 4.950 2.475 Y Mup1 n/a
25 TRCN0000105463 TCCATGCAGAAGAAGCTAGTT pLKO.1 122 CDS 100% 4.950 2.475 Y Mup2 n/a
26 TRCN0000272289 TGGCTCATCTCATTAACGAAA pLKO_005 434 CDS 100% 4.950 2.475 Y Mup9 n/a
27 TRCN0000105460 CCAATTCCAGTCTATCCACAT pLKO.1 789 3UTR 100% 4.050 2.025 Y Mup2 n/a
28 TRCN0000105462 GATAACTTTCTTATGGCTCAT pLKO.1 421 CDS 100% 4.050 2.025 Y Mup2 n/a
29 TRCN0000105445 CCCTTCCTATCCATACAGCAT pLKO.1 718 CDS 100% 2.640 1.320 Y Mup1 n/a
30 TRCN0000105464 CAAATCCATGTCTTGGAGAAA pLKO.1 259 CDS 100% 4.950 2.475 Y Mup2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006537480.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.