Transcript: Mouse XM_006537640.2

PREDICTED: Mus musculus maternal embryonic leucine zipper kinase (Melk), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Melk (17279)
Length:
2413
CDS:
236..1999

Additional Resources:

NCBI RefSeq record:
XM_006537640.2
NBCI Gene record:
Melk (17279)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006537640.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232393 ACGCAGAGCAGTGGCAAATAA pLKO_005 1279 CDS 100% 15.000 21.000 N Melk n/a
2 TRCN0000220738 GCCGAAGATTCCAGTTAGTAA pLKO.1 1372 CDS 100% 5.625 4.500 N Melk n/a
3 TRCN0000220736 CGGTTAGAACACCAGGGAATT pLKO.1 1479 CDS 100% 0.000 0.000 N Melk n/a
4 TRCN0000232394 AGTTAGTAAGAACCAGTATAA pLKO_005 1384 CDS 100% 13.200 9.240 N Melk n/a
5 TRCN0000232391 CTGGAGAGATGGTAGCTATAA pLKO_005 333 CDS 100% 13.200 9.240 N Melk n/a
6 TRCN0000220735 GCCTGGGTTTACAAGAGATTA pLKO.1 1946 CDS 100% 13.200 9.240 N Melk n/a
7 TRCN0000220739 GCAGCTCCTGAACTAATACAA pLKO.1 758 CDS 100% 5.625 3.938 N Melk n/a
8 TRCN0000220737 GCTGGATTGATAGACTATGAA pLKO.1 1160 CDS 100% 5.625 3.938 N Melk n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006537640.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.