Transcript: Mouse XM_006537897.1

PREDICTED: Mus musculus family with sequence similarity 110, member B (Fam110b), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam110b (242297)
Length:
2904
CDS:
387..1487

Additional Resources:

NCBI RefSeq record:
XM_006537897.1
NBCI Gene record:
Fam110b (242297)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006537897.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000181553 GCATCAAACAAGCTAGAGAGT pLKO.1 1444 CDS 100% 2.640 3.696 N Fam110b n/a
2 TRCN0000413570 GGCTAATTCTGACATCATATC pLKO_005 1268 CDS 100% 10.800 8.640 N Fam110b n/a
3 TRCN0000177613 CCATTGAAAGAAATGCTAGAA pLKO.1 1405 CDS 100% 4.950 3.960 N Fam110b n/a
4 TRCN0000430736 AGACTTGAGTGACAGGTATTT pLKO_005 1157 CDS 100% 13.200 9.240 N Fam110b n/a
5 TRCN0000427098 AGTAACAGTGACCTTAGAAAT pLKO_005 1344 CDS 100% 13.200 9.240 N Fam110b n/a
6 TRCN0000181356 CAGACTTGAGTGACAGGTATT pLKO.1 1156 CDS 100% 10.800 7.560 N Fam110b n/a
7 TRCN0000432791 CACAAGCATAGCTCCCGAAAC pLKO_005 795 CDS 100% 6.000 4.200 N Fam110b n/a
8 TRCN0000198212 CAAGTGGCTATATAGCATCAA pLKO.1 1430 CDS 100% 4.950 3.465 N Fam110b n/a
9 TRCN0000198503 GCTAGAATCATCAAGTGGCTA pLKO.1 1419 CDS 100% 2.640 1.848 N Fam110b n/a
10 TRCN0000198515 GCTTGAGATCCTCAAGAACAT pLKO.1 737 CDS 100% 0.495 0.347 N Fam110b n/a
11 TRCN0000116209 GCAAGGGCTAATTCTGACATA pLKO.1 1263 CDS 100% 4.950 6.930 N FAM110B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006537897.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09293 pDONR223 100% 88.5% 95.1% None (many diffs) n/a
2 ccsbBroad304_09293 pLX_304 0% 88.5% 95.1% V5 (many diffs) n/a
Download CSV