Transcript: Mouse XM_006538235.1

PREDICTED: Mus musculus tripartite motif-containing 32 (Trim32), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Trim32 (69807)
Length:
3318
CDS:
288..2255

Additional Resources:

NCBI RefSeq record:
XM_006538235.1
NBCI Gene record:
Trim32 (69807)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538235.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000040828 GCCGCAAGGAAATTCTCCATT pLKO.1 2077 CDS 100% 4.950 6.930 N Trim32 n/a
2 TRCN0000317035 GCCGCAAGGAAATTCTCCATT pLKO_005 2077 CDS 100% 4.950 6.930 N Trim32 n/a
3 TRCN0000040832 GCTATCATCTGAGAAGATATT pLKO.1 2224 CDS 100% 13.200 9.240 N Trim32 n/a
4 TRCN0000316961 GCTATCATCTGAGAAGATATT pLKO_005 2224 CDS 100% 13.200 9.240 N Trim32 n/a
5 TRCN0000040829 CCCAAGTTTGTCACCTGTGAT pLKO.1 1839 CDS 100% 4.950 3.465 N Trim32 n/a
6 TRCN0000316959 CCCAAGTTTGTCACCTGTGAT pLKO_005 1839 CDS 100% 4.950 3.465 N Trim32 n/a
7 TRCN0000040830 GCATTGATAGCTTCGTGCTAA pLKO.1 1531 CDS 100% 4.950 3.465 N Trim32 n/a
8 TRCN0000316958 GCATTGATAGCTTCGTGCTAA pLKO_005 1531 CDS 100% 4.950 3.465 N Trim32 n/a
9 TRCN0000040831 GCTAGAATGTCCCATCTGCAT pLKO.1 341 CDS 100% 2.640 1.848 N Trim32 n/a
10 TRCN0000316960 GCTAGAATGTCCCATCTGCAT pLKO_005 341 CDS 100% 2.640 1.848 N Trim32 n/a
11 TRCN0000010787 GTGGTCAAATACAGCTGCCTA pLKO.1 1803 CDS 100% 2.640 1.848 N TRIM32 n/a
12 TRCN0000003458 TCTTGGACTGTTGGGATCATT pLKO.1 2188 CDS 100% 5.625 3.375 N TRIM32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538235.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02708 pDONR223 100% 87.7% 95.8% None (many diffs) n/a
2 ccsbBroad304_02708 pLX_304 0% 87.7% 95.8% V5 (many diffs) n/a
Download CSV