Transcript: Mouse XM_006538332.2

PREDICTED: Mus musculus ankyrin repeat and sterile alpha motif domain containing 6 (Anks6), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Anks6 (75691)
Length:
4109
CDS:
56..2707

Additional Resources:

NCBI RefSeq record:
XM_006538332.2
NBCI Gene record:
Anks6 (75691)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538332.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254898 CCGCATGGCTGCAGATGTAAA pLKO_005 2948 3UTR 100% 13.200 18.480 N Anks6 n/a
2 TRCN0000179827 CCATTCACAACTTCCACTCTT pLKO.1 2589 CDS 100% 4.950 3.960 N Anks6 n/a
3 TRCN0000179150 GTACAGGGATCTTGCTGAATA pLKO.1 835 CDS 100% 13.200 9.240 N Anks6 n/a
4 TRCN0000254899 TGTGGCTGCCGTGGTTCATTT pLKO_005 3077 3UTR 100% 13.200 9.240 N Anks6 n/a
5 TRCN0000254901 TTGTAGTCTAGCTGCACATAA pLKO_005 3300 3UTR 100% 13.200 9.240 N Anks6 n/a
6 TRCN0000267514 AGCTCGATGTTCTCCCTAATG pLKO_005 3136 3UTR 100% 10.800 7.560 N Anks6 n/a
7 TRCN0000254900 CCCATAGGCTTCCTTCTTAAG pLKO_005 3421 3UTR 100% 10.800 7.560 N Anks6 n/a
8 TRCN0000184055 CCAGTCATGTCCATCAGGATA pLKO.1 3557 3UTR 100% 4.950 3.465 N Anks6 n/a
9 TRCN0000139349 GAACAAGAGGTGGACATGGAA pLKO.1 2435 CDS 100% 3.000 2.100 N ANKS6 n/a
10 TRCN0000143107 GATGAACTGACTGGAATCCTT pLKO.1 2375 CDS 100% 3.000 2.100 N ANKS6 n/a
11 TRCN0000121799 CTGACTGGAATCCTTAAGAAA pLKO.1 2381 CDS 100% 5.625 3.938 N ANKS6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538332.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.