Transcript: Mouse XM_006538626.3

PREDICTED: Mus musculus neuroblastoma, suppression of tumorigenicity 1 (Nbl1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nbl1 (17965)
Length:
1742
CDS:
152..688

Additional Resources:

NCBI RefSeq record:
XM_006538626.3
NBCI Gene record:
Nbl1 (17965)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538626.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434608 CGTCTATGTGCAGGGTGAAGA pLKO_005 547 CDS 100% 4.950 6.930 N Nbl1 n/a
2 TRCN0000042413 GCCAAGCTGCACAATTTAATA pLKO.1 848 3UTR 100% 15.000 12.000 N Nbl1 n/a
3 TRCN0000436196 AGCTCCAGTCCCATAGGTTTC pLKO_005 1156 3UTR 100% 6.000 4.800 N Nbl1 n/a
4 TRCN0000042414 CCTAGGACAATGCTTCAGTTA pLKO.1 325 CDS 100% 4.950 3.465 N Nbl1 n/a
5 TRCN0000438863 CTTTGCTGAAGGACCTATGTG pLKO_005 1111 3UTR 100% 4.950 3.465 N Nbl1 n/a
6 TRCN0000042415 GCCAAGAACATCACGCAGATT pLKO.1 257 CDS 100% 4.950 3.465 N Nbl1 n/a
7 TRCN0000042417 TGAGGCCAAGTCTATCCAGAA pLKO.1 295 CDS 100% 4.050 2.835 N Nbl1 n/a
8 TRCN0000438233 GAAGGTGAAGTGTGGTCTTTC pLKO_005 920 3UTR 100% 10.800 6.480 N Nbl1 n/a
9 TRCN0000042416 GCCCAGTCCATGTGGGAGATT pLKO.1 410 CDS 100% 1.650 0.990 N Nbl1 n/a
10 TRCN0000038035 CAGTCCACAGAGTCCCTGGTT pLKO.1 368 CDS 100% 0.880 0.616 N NBL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538626.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.