Transcript: Mouse XM_006538688.4

PREDICTED: Mus musculus syndecan 3 (Sdc3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Sdc3 (20970)
Length:
5047
CDS:
252..1538

Additional Resources:

NCBI RefSeq record:
XM_006538688.4
NBCI Gene record:
Sdc3 (20970)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538688.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348586 ATGCTACCCACAACCGTTATC pLKO_005 540 CDS 100% 10.800 15.120 N Sdc3 n/a
2 TRCN0000071988 GCTCATCTACCGCATGAAGAA pLKO.1 1427 CDS 100% 4.950 3.960 N Sdc3 n/a
3 TRCN0000334195 GCTCATCTACCGCATGAAGAA pLKO_005 1427 CDS 100% 4.950 3.960 N Sdc3 n/a
4 TRCN0000071989 CATGCGGTTCATCCCTGATAT pLKO.1 491 CDS 100% 13.200 9.240 N Sdc3 n/a
5 TRCN0000071991 CACGTACCAGAAACCTGACAA pLKO.1 1496 CDS 100% 4.950 3.465 N Sdc3 n/a
6 TRCN0000334196 CACGTACCAGAAACCTGACAA pLKO_005 1496 CDS 100% 4.950 3.465 N Sdc3 n/a
7 TRCN0000071990 GACGACTCGTTTCCTGATGAT pLKO.1 402 CDS 100% 4.950 3.465 N Sdc3 n/a
8 TRCN0000334194 GACGACTCGTTTCCTGATGAT pLKO_005 402 CDS 100% 4.950 3.465 N Sdc3 n/a
9 TRCN0000071992 TCCACGACAATGCCATCGATT pLKO.1 1288 CDS 100% 4.950 3.465 N Sdc3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538688.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.