Transcript: Mouse XM_006538765.1

PREDICTED: Mus musculus endothelin converting enzyme 1 (Ece1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ece1 (230857)
Length:
4739
CDS:
107..2416

Additional Resources:

NCBI RefSeq record:
XM_006538765.1
NBCI Gene record:
Ece1 (230857)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538765.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348817 TCATCAACAACACCGACAAAT pLKO_005 1245 CDS 100% 13.200 9.240 N Ece1 n/a
2 TRCN0000348818 TTGCCCTCCAGAGACTATTAC pLKO_005 887 CDS 100% 13.200 9.240 N Ece1 n/a
3 TRCN0000031173 CAAGGAGTTCTCAGAACACTT pLKO.1 2341 CDS 100% 4.950 3.465 N Ece1 n/a
4 TRCN0000352007 CAAGGAGTTCTCAGAACACTT pLKO_005 2341 CDS 100% 4.950 3.465 N Ece1 n/a
5 TRCN0000031171 CCAGCTCTTCTTCCTAGGATT pLKO.1 2212 CDS 100% 4.950 3.465 N Ece1 n/a
6 TRCN0000031172 CCTGACTGGATACCTGAACTA pLKO.1 934 CDS 100% 4.950 3.465 N Ece1 n/a
7 TRCN0000352083 CCTGACTGGATACCTGAACTA pLKO_005 934 CDS 100% 4.950 3.465 N Ece1 n/a
8 TRCN0000031170 CCAACAGAGATCAGTGGAGTA pLKO.1 1761 CDS 100% 4.050 2.835 N Ece1 n/a
9 TRCN0000031169 GCCATCAACTGGTTACCCTTT pLKO.1 1136 CDS 100% 4.050 2.835 N Ece1 n/a
10 TRCN0000438378 ACTACTCGCCCACCAAGAATG pLKO_005 1806 CDS 100% 10.800 6.480 N ECE1 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4069 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538765.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.