Transcript: Mouse XM_006538801.3

PREDICTED: Mus musculus ciliary rootlet coiled-coil, rootletin (Crocc), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Crocc (230872)
Length:
6657
CDS:
441..6248

Additional Resources:

NCBI RefSeq record:
XM_006538801.3
NBCI Gene record:
Crocc (230872)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538801.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000181354 CCAGGACAAGCTGGAATTAAA pLKO.1 2468 CDS 100% 15.000 10.500 N Crocc n/a
2 TRCN0000250754 CCAGGACAAGCTGGAATTAAA pLKO_005 2468 CDS 100% 15.000 10.500 N Crocc n/a
3 TRCN0000250753 AGCTGGCCATCAAGTACAATG pLKO_005 541 CDS 100% 10.800 7.560 N Crocc n/a
4 TRCN0000250751 CTCAGGAAGACGCTGGATAAG pLKO_005 5829 CDS 100% 10.800 7.560 N Crocc n/a
5 TRCN0000258081 TACGGCAGAGGTTGCTGAAAG pLKO_005 4201 CDS 100% 10.800 7.560 N Crocc n/a
6 TRCN0000178200 CATCAAGTACAATGCTGTCAA pLKO.1 548 CDS 100% 4.950 3.465 N Crocc n/a
7 TRCN0000217891 GAGTTGCTACAACCTGTACTA pLKO.1 6374 3UTR 100% 4.950 3.465 N Crocc n/a
8 TRCN0000250752 TGGCTTCTCAGAGTTGCTACA pLKO_005 6364 3UTR 100% 4.050 2.835 N Crocc n/a
9 TRCN0000182152 CAGTACAAGAAGCAGTGCTCA pLKO.1 768 CDS 100% 2.640 1.848 N Crocc n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538801.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.