Transcript: Mouse XM_006538867.2

PREDICTED: Mus musculus nephronophthisis 4 (juvenile) homolog (human) (Nphp4), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nphp4 (260305)
Length:
4856
CDS:
137..4450

Additional Resources:

NCBI RefSeq record:
XM_006538867.2
NBCI Gene record:
Nphp4 (260305)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538867.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000184114 CCACTGAGTACGAACAGGAAA pLKO.1 2532 CDS 100% 4.950 3.960 N Nphp4 n/a
2 TRCN0000183428 CGATGTCACCTACAAACATTT pLKO.1 325 CDS 100% 13.200 9.240 N Nphp4 n/a
3 TRCN0000183320 GTTCTTCGAGTTTGCACTTAA pLKO.1 3136 CDS 100% 13.200 9.240 N Nphp4 n/a
4 TRCN0000217622 GTTCGATGCAGTGATCCAAAT pLKO.1 3683 CDS 100% 10.800 7.560 N Nphp4 n/a
5 TRCN0000180423 GCACTTAGATGACCTCTTCTT pLKO.1 898 CDS 100% 4.950 3.465 N Nphp4 n/a
6 TRCN0000184308 GCCACTCATTAAGCAGGGAAT pLKO.1 256 CDS 100% 4.050 2.835 N Nphp4 n/a
7 TRCN0000195936 CCGTTAGGAAAGTGAGAGCTT pLKO.1 3939 CDS 100% 2.640 1.848 N Nphp4 n/a
8 TRCN0000083164 CCCGGAGATCAAAGACTTCTT pLKO.1 3778 CDS 100% 4.950 2.970 N NPHP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538867.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.