Transcript: Mouse XM_006538884.3

PREDICTED: Mus musculus matrix metallopeptidase 23 (Mmp23), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mmp23 (26561)
Length:
2511
CDS:
1360..2457

Additional Resources:

NCBI RefSeq record:
XM_006538884.3
NBCI Gene record:
Mmp23 (26561)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538884.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221502 GATAGGTTTCTACCCAGTCAA pLKO.1 1872 CDS 100% 4.950 6.930 N Mmp23 n/a
2 TRCN0000352265 GATAGGTTTCTACCCAGTCAA pLKO_005 1872 CDS 100% 4.950 6.930 N Mmp23 n/a
3 TRCN0000221500 GCCTTTCGAATGTGGAGTGAT pLKO.1 1798 CDS 100% 4.950 6.930 N Mmp23 n/a
4 TRCN0000352264 GCCTTTCGAATGTGGAGTGAT pLKO_005 1798 CDS 100% 4.950 6.930 N Mmp23 n/a
5 TRCN0000221504 AGGGAAATGTAGATGCGCCAA pLKO.1 1511 CDS 100% 2.160 3.024 N Mmp23 n/a
6 TRCN0000221503 CACACGCTACAGTTGGAAGAA pLKO.1 2022 CDS 100% 4.950 3.465 N Mmp23 n/a
7 TRCN0000352266 CACACGCTACAGTTGGAAGAA pLKO_005 2022 CDS 100% 4.950 3.465 N Mmp23 n/a
8 TRCN0000221501 CCAGAAGCTGTGATTTCTGTT pLKO.1 2132 CDS 100% 0.495 0.347 N Mmp23 n/a
9 TRCN0000352267 CCAGAAGCTGTGATTTCTGTT pLKO_005 2132 CDS 100% 0.495 0.347 N Mmp23 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538884.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.