Transcript: Mouse XM_006538954.3

PREDICTED: Mus musculus cation channel, sperm associated 4 (Catsper4), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Catsper4 (329954)
Length:
1199
CDS:
94..1113

Additional Resources:

NCBI RefSeq record:
XM_006538954.3
NBCI Gene record:
Catsper4 (329954)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538954.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246958 ACATTGTGTTGACGATCCTTA pLKO_005 410 CDS 100% 4.950 6.930 N Catsper4 n/a
2 TRCN0000257590 TGCTGCTGTCCAACGCTATCA pLKO_005 323 CDS 100% 4.950 6.930 N Catsper4 n/a
3 TRCN0000217710 GGCCAGAATCATCAAGGTTAT pLKO.1 621 CDS 100% 10.800 8.640 N Catsper4 n/a
4 TRCN0000246961 GCCCTTCGCACCAACTCTTAT pLKO_005 349 CDS 100% 13.200 9.240 N Catsper4 n/a
5 TRCN0000216174 CAGAAACATTACGAGCTATTC pLKO.1 376 CDS 100% 10.800 7.560 N Catsper4 n/a
6 TRCN0000246959 TCAGAAACATTACGAGCTATT pLKO_005 375 CDS 100% 10.800 7.560 N Catsper4 n/a
7 TRCN0000195900 CCCTGAGTAACCTCACAGAAA pLKO.1 1108 CDS 100% 4.950 3.465 N Catsper4 n/a
8 TRCN0000157595 GCCCAAGCATTTCCAGAACAT pLKO.1 741 CDS 100% 4.950 3.465 N CATSPER4 n/a
9 TRCN0000184365 GCTGGACATCTACACTGACTT pLKO.1 810 CDS 100% 4.950 3.465 N Catsper4 n/a
10 TRCN0000246960 AGAAGGATGCCTGGGATGTAC pLKO_005 230 CDS 100% 4.950 2.970 N Catsper4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538954.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.