Transcript: Mouse XM_006538989.3

PREDICTED: Mus musculus X-linked Kx blood group related 8 (Xkr8), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Xkr8 (381560)
Length:
1663
CDS:
206..1105

Additional Resources:

NCBI RefSeq record:
XM_006538989.3
NBCI Gene record:
Xkr8 (381560)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538989.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000198742 CACCCTGTTAGCAGAGAACTT pLKO.1 1021 CDS 100% 4.950 3.465 N Xkr8 n/a
2 TRCN0000198070 CCTGTTAGCAGAGAACTTCTT pLKO.1 1024 CDS 100% 4.950 3.465 N Xkr8 n/a
3 TRCN0000178308 GAGTTCCTCTGCTATCTACTT pLKO.1 490 CDS 100% 4.950 3.465 N Xkr8 n/a
4 TRCN0000181765 GCTCATCCTTTCTTGGCATCT pLKO.1 402 CDS 100% 4.050 2.835 N Xkr8 n/a
5 TRCN0000141645 CTATTTCTCCTGGTTCAACGT pLKO.1 706 CDS 100% 2.640 1.848 N XKR8 n/a
6 TRCN0000177915 CATCCTCTATTTCTCCTGGTT pLKO.1 700 CDS 100% 2.640 1.584 N Xkr8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538989.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.