Transcript: Mouse XM_006539157.3

PREDICTED: Mus musculus castor zinc finger 1 (Casz1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Casz1 (69743)
Length:
8576
CDS:
594..6254

Additional Resources:

NCBI RefSeq record:
XM_006539157.3
NBCI Gene record:
Casz1 (69743)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006539157.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238975 ACGGATTGCCCACAGATAAAC pLKO_005 2005 CDS 100% 13.200 18.480 N Casz1 n/a
2 TRCN0000238974 GCAGGATGTGATCCGACATTA pLKO_005 2177 CDS 100% 13.200 18.480 N Casz1 n/a
3 TRCN0000125162 CCACGGCAAGCAGGACGTGAT pLKO.1 5573 CDS 100% 0.000 0.000 N Casz1 n/a
4 TRCN0000238976 TGATCGAGAAATGGGTCAATG pLKO_005 925 CDS 100% 10.800 8.640 N Casz1 n/a
5 TRCN0000125161 GACAGCCTCGTCTCGGAAGAT pLKO.1 5216 CDS 100% 1.650 1.320 N Casz1 n/a
6 TRCN0000244256 CAAGTACGAGGAGTGCAAATA pLKO_005 2609 CDS 100% 13.200 9.240 N Casz1 n/a
7 TRCN0000125159 CCCTCTAGAACTGCTCTGTAT pLKO.1 6274 3UTR 100% 4.950 3.465 N Casz1 n/a
8 TRCN0000125160 CGACTGCAAGTACAAGCTCAA pLKO.1 5645 CDS 100% 4.050 2.835 N Casz1 n/a
9 TRCN0000131029 CGAGTACCTGAAGTCAACCTT pLKO.1 1937 CDS 100% 3.000 2.100 N CASZ1 n/a
10 TRCN0000125163 TGTCTCCCTTTGGCAAGCGAA pLKO.1 5191 CDS 100% 2.640 1.848 N Casz1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006539157.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.