Transcript: Mouse XM_006539212.3

PREDICTED: Mus musculus PPARGC1 and ESRR induced regulator, muscle 1 (Perm1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Perm1 (74183)
Length:
4322
CDS:
829..3252

Additional Resources:

NCBI RefSeq record:
XM_006539212.3
NBCI Gene record:
Perm1 (74183)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006539212.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000201009 CCCTTGGTACTGATTTACTTA pLKO.1 3375 3UTR 100% 5.625 7.875 N Perm1 n/a
2 TRCN0000201572 CAGCGGAACATCTTAGCTTAA pLKO.1 2978 CDS 100% 10.800 7.560 N Perm1 n/a
3 TRCN0000201051 CCTTCAAATGTCAACCCAATA pLKO.1 1826 CDS 100% 10.800 7.560 N Perm1 n/a
4 TRCN0000215404 CTAAAGAGAGTGTGTCTATAC pLKO.1 2168 CDS 100% 10.800 7.560 N Perm1 n/a
5 TRCN0000191460 CCTATTCTGATAACTGAACAA pLKO.1 1588 CDS 100% 4.950 3.465 N Perm1 n/a
6 TRCN0000192210 CCAAGAAGAAGAAAGTACGAT pLKO.1 2342 CDS 100% 3.000 1.800 N Perm1 n/a
7 TRCN0000201750 GAACACTTCTTCACTGAGGAA pLKO.1 2860 CDS 100% 2.640 1.584 N Perm1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006539212.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.