Transcript: Mouse XM_006539327.3

PREDICTED: Mus musculus AT rich interactive domain 1A (SWI-like) (Arid1a), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Arid1a (93760)
Length:
6460
CDS:
77..5788

Additional Resources:

NCBI RefSeq record:
XM_006539327.3
NBCI Gene record:
Arid1a (93760)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006539327.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238302 CAGGCCCTATGGCCCTAATAT pLKO_005 1519 CDS 100% 15.000 21.000 N Arid1a n/a
2 TRCN0000238303 TGCCCAAGATCGAGGTTATAT pLKO_005 1162 CDS 100% 15.000 21.000 N Arid1a n/a
3 TRCN0000238305 TGGGCGTTAGACACCATTAAC pLKO_005 3995 CDS 100% 13.200 18.480 N Arid1a n/a
4 TRCN0000240070 TGGACCTCTATCGCCTCTATG pLKO_005 2070 CDS 100% 10.800 15.120 N LOC675933 n/a
5 TRCN0000358749 TGGACCTCTATCGCCTCTATG pLKO_005 2070 CDS 100% 10.800 15.120 N ARID1A n/a
6 TRCN0000256974 TTGTGCCAGGCAACGACTTTG pLKO_005 4908 CDS 100% 10.800 15.120 N LOC675933 n/a
7 TRCN0000071395 CGAAATGACATGACCTACAAT pLKO.1 3440 CDS 100% 5.625 7.875 N Arid1a n/a
8 TRCN0000240072 ATTTCCGTAGATGCCTAATTG pLKO_005 4095 CDS 100% 13.200 10.560 N LOC675933 n/a
9 TRCN0000240071 ACTGACTGTTGCCCTTTATTT pLKO_005 5845 3UTR 100% 15.000 10.500 N LOC675933 n/a
10 TRCN0000071397 CATTGGTTTCACAAGTCATTT pLKO.1 5736 CDS 100% 13.200 9.240 N Arid1a n/a
11 TRCN0000071394 GCATGTCCTATGAGCCAAATA pLKO.1 2592 CDS 100% 13.200 9.240 N Arid1a n/a
12 TRCN0000240073 GCAACAGCAACGACATGATTC pLKO_005 2932 CDS 100% 10.800 7.560 N LOC675933 n/a
13 TRCN0000071396 GCCTGATCTGTCTGGTTCAAT pLKO.1 841 CDS 100% 5.625 3.938 N Arid1a n/a
14 TRCN0000059088 CGGCTCACAATGAAAGACATT pLKO.1 3911 CDS 100% 4.950 3.465 N ARID1A n/a
15 TRCN0000238306 CCTAGGCAGCCTAACTATAAT pLKO_005 1352 CDS 100% 15.000 9.000 N Arid1a n/a
16 TRCN0000071393 CCCAGAGATTGGTCTTGGAAA pLKO.1 5271 CDS 100% 4.950 2.970 N Arid1a n/a
17 TRCN0000358684 TATCCCTATGGAGGTCCTTAT pLKO_005 2759 CDS 100% 10.800 7.560 N ARID1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006539327.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.