Transcript: Mouse XM_006539457.4

PREDICTED: Mus musculus latent transforming growth factor beta binding protein 4 (Ltbp4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Ltbp4 (108075)
Length:
5153
CDS:
44..4897

Additional Resources:

NCBI RefSeq record:
XM_006539457.4
NBCI Gene record:
Ltbp4 (108075)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006539457.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314014 GCCTTACCCGCTCCGTTTATA pLKO_005 627 CDS 100% 15.000 21.000 N Ltbp4 n/a
2 TRCN0000065789 CGCTGCCCATTCTTCGAAATA pLKO.1 1296 CDS 100% 13.200 18.480 N Ltbp4 n/a
3 TRCN0000350007 GCGCCAAATCTCCCACTATAC pLKO_005 4904 3UTR 100% 10.800 15.120 N Ltbp4 n/a
4 TRCN0000313942 TCGCTGCCCATTCTTCGAAAT pLKO_005 1295 CDS 100% 10.800 15.120 N Ltbp4 n/a
5 TRCN0000065792 CCGGGTCCTATGTCCCTTGAT pLKO.1 487 CDS 100% 1.650 2.310 N Ltbp4 n/a
6 TRCN0000314013 CAGGCTGGAGTGCGTTGATAA pLKO_005 3892 CDS 100% 13.200 9.240 N Ltbp4 n/a
7 TRCN0000065790 GATGTACTGATGTGGATGAAT pLKO.1 2664 CDS 100% 5.625 3.938 N Ltbp4 n/a
8 TRCN0000317524 GATGTACTGATGTGGATGAAT pLKO_005 2664 CDS 100% 5.625 3.938 N Ltbp4 n/a
9 TRCN0000065788 CCTATGAATATGGCCCAGATA pLKO.1 4284 CDS 100% 4.950 3.465 N Ltbp4 n/a
10 TRCN0000065791 CAGATGACTTTGAGGCCCTTT pLKO.1 4206 CDS 100% 4.050 2.835 N Ltbp4 n/a
11 TRCN0000055832 TGTCCCTTGATCTGTCACAAT pLKO.1 497 CDS 100% 4.950 6.930 N LTBP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006539457.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.