Transcript: Mouse XM_006539510.3

PREDICTED: Mus musculus cytochrome P450, family 2, subfamily b, polypeptide 13 (Cyp2b13), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cyp2b13 (13089)
Length:
1832
CDS:
80..1456

Additional Resources:

NCBI RefSeq record:
XM_006539510.3
NBCI Gene record:
Cyp2b13 (13089)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006539510.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126600 CCAGTGTGTTACAGCCAATAT pLKO.1 670 CDS 100% 13.200 9.240 N Cyp2b13 n/a
2 TRCN0000126599 GCTCACATCTTTCCTCCTATT pLKO.1 1552 3UTR 100% 10.800 7.560 N Cyp2b13 n/a
3 TRCN0000126601 AGATGAACAGTTCCTGCGTTT pLKO.1 730 CDS 100% 4.050 2.835 N Cyp2b13 n/a
4 TRCN0000425874 TGCTGGAAACTAGACTGTATG pLKO_005 1526 3UTR 100% 10.800 6.480 N Cyp2b13 n/a
5 TRCN0000126602 CCCGCAACGAATTGTTCCTTT pLKO.1 1305 CDS 100% 4.950 2.970 N Cyp2b13 n/a
6 TRCN0000437015 TCTACCCTTCTCCACAGGAAA pLKO_005 1258 CDS 100% 4.950 2.970 N Cyp2b13 n/a
7 TRCN0000126603 GCTGTCCTTCTGAGCTTATTT pLKO.1 40 5UTR 100% 15.000 7.500 Y Cyp2b13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006539510.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.