Transcript: Mouse XM_006539553.3

PREDICTED: Mus musculus glutamate receptor, ionotropic, kainate 5 (gamma 2) (Grik5), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Grik5 (14809)
Length:
3595
CDS:
709..3075

Additional Resources:

NCBI RefSeq record:
XM_006539553.3
NBCI Gene record:
Grik5 (14809)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006539553.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100279 TCCTGGAGAACCCGTATGTTA pLKO.1 1400 CDS 100% 5.625 7.875 N Grik5 n/a
2 TRCN0000100277 CCAACATTGAGTACGGCACTA pLKO.1 2120 CDS 100% 4.050 5.670 N Grik5 n/a
3 TRCN0000100276 CCTGGAGAACCCGTATGTTAT pLKO.1 1401 CDS 100% 13.200 9.240 N Grik5 n/a
4 TRCN0000423242 GTTTGGGCATGGAGAACATTG pLKO_005 2528 CDS 100% 10.800 7.560 N GRIK5 n/a
5 TRCN0000100278 GCTGGGAATGACCTCAGCGTT pLKO.1 831 CDS 100% 0.880 0.616 N Grik5 n/a
6 TRCN0000100275 GCCTTCAATTCCTGGTGAAGT pLKO.1 3155 3UTR 100% 0.495 0.347 N Grik5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006539553.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.