Transcript: Mouse XM_006539565.3

PREDICTED: Mus musculus Rho guanine nucleotide exchange factor (GEF) 1 (Arhgef1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Arhgef1 (16801)
Length:
3816
CDS:
530..3472

Additional Resources:

NCBI RefSeq record:
XM_006539565.3
NBCI Gene record:
Arhgef1 (16801)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006539565.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437366 ACCCTATGCTGAGCGAGTTCA pLKO_005 2601 CDS 100% 4.950 3.465 N ARHGEF1 n/a
2 TRCN0000110050 AGAGGGAGATTGGCTGAACTT pLKO.1 3558 3UTR 100% 4.950 3.465 N Arhgef1 n/a
3 TRCN0000110052 CCTACAGTTAAAGGACATGAT pLKO.1 2359 CDS 100% 4.950 3.465 N Arhgef1 n/a
4 TRCN0000110051 CCTTGACTTCTATCACAGTTT pLKO.1 811 CDS 100% 4.950 3.465 N Arhgef1 n/a
5 TRCN0000110053 CCTGATCTGATCTCTGAGGAT pLKO.1 902 CDS 100% 2.640 1.848 N Arhgef1 n/a
6 TRCN0000110054 GTGACCAAAGACAAAGCTATA pLKO.1 2678 CDS 100% 10.800 6.480 N Arhgef1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006539565.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15657 pDONR223 0% 77.3% 78.9% None (many diffs) n/a
2 ccsbBroad304_15657 pLX_304 0% 77.3% 78.9% V5 (many diffs) n/a
Download CSV