Transcript: Mouse XM_006539695.1

PREDICTED: Mus musculus solute carrier family 1 (neutral amino acid transporter), member 5 (Slc1a5), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc1a5 (20514)
Length:
1514
CDS:
135..1010

Additional Resources:

NCBI RefSeq record:
XM_006539695.1
NBCI Gene record:
Slc1a5 (20514)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006539695.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000340675 TAGATCTCGTGAGGAATATTT pLKO_005 66 5UTR 100% 15.000 21.000 N Slc1a5 n/a
2 TRCN0000340674 CTTCATCAGCCTCGGCAAATA pLKO_005 278 CDS 100% 13.200 18.480 N Slc1a5 n/a
3 TRCN0000079262 CCGAATTGATCCAGGTGAAGA pLKO.1 871 CDS 100% 4.950 6.930 N Slc1a5 n/a
4 TRCN0000079258 CCTGTAGAGTTCTCTACCCTT pLKO.1 1306 3UTR 100% 0.264 0.370 N Slc1a5 n/a
5 TRCN0000327527 CCTGTAGAGTTCTCTACCCTT pLKO_005 1306 3UTR 100% 0.264 0.370 N Slc1a5 n/a
6 TRCN0000340676 GTATCCAGCGGGAGATCAATT pLKO_005 174 CDS 100% 13.200 10.560 N Slc1a5 n/a
7 TRCN0000079260 GCCCGAATTGATCCAGGTGAA pLKO.1 869 CDS 100% 4.050 3.240 N Slc1a5 n/a
8 TRCN0000327609 GCCCGAATTGATCCAGGTGAA pLKO_005 869 CDS 100% 4.050 3.240 N Slc1a5 n/a
9 TRCN0000079259 GCAGTGTTCATCGCACAACTA pLKO.1 576 CDS 100% 4.950 3.465 N Slc1a5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006539695.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.