Transcript: Mouse XM_006539701.3

PREDICTED: Mus musculus aurora kinase C (Aurkc), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Aurkc (20871)
Length:
1219
CDS:
243..1073

Additional Resources:

NCBI RefSeq record:
XM_006539701.3
NBCI Gene record:
Aurkc (20871)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006539701.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361475 CTATGATGACACTCGGATATA pLKO_005 491 CDS 100% 13.200 9.240 N Aurkc n/a
2 TRCN0000361478 CAGCGTACAGCCACGATAATA pLKO_005 582 CDS 100% 15.000 9.000 N Aurkc n/a
3 TRCN0000361477 TAGCGCAGAAACCGTACAATG pLKO_005 793 CDS 100% 10.800 6.480 N Aurkc n/a
4 TRCN0000027621 CCGGAAATGATAGCGCAGAAA pLKO.1 783 CDS 100% 4.950 2.970 N Aurkc n/a
5 TRCN0000361476 CTTGATCTCCAAGCTTCTTAG pLKO_005 965 CDS 100% 10.800 5.400 Y Aurkc n/a
6 TRCN0000027648 CCATGAGAAGAAGGTGATTCA pLKO.1 632 CDS 100% 4.950 2.475 Y Aurkc n/a
7 TRCN0000027633 CCGTACAATGAGATGGTTGAT pLKO.1 804 CDS 100% 4.950 2.475 Y Aurkc n/a
8 TRCN0000079020 GTCCTCTTCAAGTCTGAGATA pLKO.1 378 CDS 100% 4.950 2.475 Y LOC385186 n/a
9 TRCN0000027610 GCACCTCCAGTGAGACATATA pLKO.1 886 CDS 100% 13.200 6.600 Y LOC381698 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006539701.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.