Transcript: Mouse XM_006539711.3

PREDICTED: Mus musculus predicted gene 4763 (Gm4763), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm4763 (210155)
Length:
1374
CDS:
390..1136

Additional Resources:

NCBI RefSeq record:
XM_006539711.3
NBCI Gene record:
Gm4763 (210155)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006539711.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109857 TCTCTCATATTGGCAAGTAAA pLKO.1 603 CDS 100% 13.200 18.480 N Gm4763 n/a
2 TRCN0000109856 CCAAACTTCAATCGGAATCTT pLKO.1 980 CDS 100% 5.625 7.875 N Gm4763 n/a
3 TRCN0000109858 CCTAAGGACACTCGTTGCTAT pLKO.1 867 CDS 100% 4.950 3.960 N Gm4763 n/a
4 TRCN0000109859 CCCTAAGGACACTCGTTGCTA pLKO.1 866 CDS 100% 3.000 2.400 N Gm4763 n/a
5 TRCN0000109855 CCATTTCCTGACCATTCTTAA pLKO.1 1139 3UTR 100% 13.200 6.600 Y Gm4763 n/a
6 TRCN0000109880 TGACCATTCTTAATCCCTCTT pLKO.1 1147 3UTR 100% 4.050 2.025 Y Cd177 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006539711.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.