Transcript: Mouse XM_006540186.3

PREDICTED: Mus musculus GRAM domain containing 1A (Gramd1a), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gramd1a (52857)
Length:
2647
CDS:
24..2282

Additional Resources:

NCBI RefSeq record:
XM_006540186.3
NBCI Gene record:
Gramd1a (52857)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540186.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000329028 CTATTGACAGACACGAGTAAC pLKO_005 1131 CDS 100% 10.800 15.120 N Gramd1a n/a
2 TRCN0000191417 CATAGAACCAAGATGCACTTT pLKO.1 2431 3UTR 100% 4.950 6.930 N Gramd1a n/a
3 TRCN0000329027 CATAGAACCAAGATGCACTTT pLKO_005 2431 3UTR 100% 4.950 6.930 N Gramd1a n/a
4 TRCN0000192653 GACCACAATTTCCATCCAGTT pLKO.1 530 CDS 100% 4.050 3.240 N Gramd1a n/a
5 TRCN0000192071 CGAAGATTATTTCCACCACCT pLKO.1 1664 CDS 100% 2.160 1.728 N Gramd1a n/a
6 TRCN0000379138 GAAGCTACATCAAGGAATTAC pLKO_005 2207 CDS 100% 13.200 9.240 N Gramd1a n/a
7 TRCN0000192645 GCTGTCTAGAGAGGAACTATT pLKO.1 1115 CDS 100% 13.200 9.240 N Gramd1a n/a
8 TRCN0000329029 TTCCGCTGGGAGACCACAATT pLKO_005 519 CDS 100% 13.200 9.240 N Gramd1a n/a
9 TRCN0000379139 AGAGCGCCTCATCGTGGATTA pLKO_005 416 CDS 100% 10.800 7.560 N Gramd1a n/a
10 TRCN0000430867 ATGCAGAGCTGGTACAGTATG pLKO_005 330 CDS 100% 10.800 7.560 N GRAMD1A n/a
11 TRCN0000192431 CGGAAACTGTTCAGCAAACTT pLKO.1 387 CDS 100% 5.625 3.938 N Gramd1a n/a
12 TRCN0000190655 GCTTCGTGTATCCTCAGAGAT pLKO.1 1577 CDS 100% 4.950 3.465 N Gramd1a n/a
13 TRCN0000136936 CGCTCATTGAGAAGAACTCGT pLKO.1 1633 CDS 100% 2.640 1.848 N GRAMD1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540186.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.