Transcript: Mouse XM_006540193.2

PREDICTED: Mus musculus CLK4-associating serine/arginine rich protein (Clasrp), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Clasrp (53609)
Length:
1904
CDS:
84..1826

Additional Resources:

NCBI RefSeq record:
XM_006540193.2
NBCI Gene record:
Clasrp (53609)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540193.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000307395 AGAATGGGAACGCCAATATAG pLKO_005 1706 CDS 100% 13.200 18.480 N Clasrp n/a
2 TRCN0000294731 CCGTTCAGGTGACCGCTATAA pLKO_005 1196 CDS 100% 13.200 18.480 N Clasrp n/a
3 TRCN0000123556 GCTACACCTATGAAGATAGTA pLKO.1 286 CDS 100% 5.625 4.500 N Clasrp n/a
4 TRCN0000294730 AGCAGGTGGCTGATCTCAATA pLKO_005 442 CDS 100% 13.200 9.240 N Clasrp n/a
5 TRCN0000307393 AGGAGTCAGACGAGCGGAAAT pLKO_005 106 CDS 100% 10.800 7.560 N Clasrp n/a
6 TRCN0000123555 CGGGAGTACTATGAGAAGATT pLKO.1 74 5UTR 100% 5.625 3.938 N Clasrp n/a
7 TRCN0000123554 GCTACAGTCGAGAGTACAGTT pLKO.1 1753 CDS 100% 4.950 3.465 N Clasrp n/a
8 TRCN0000123557 GAGGCCATCAAACATGCCAAA pLKO.1 534 CDS 100% 4.050 2.835 N Clasrp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540193.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.