Transcript: Mouse XM_006540238.3

PREDICTED: Mus musculus pregnancy-specific glycoprotein 26 (Psg26), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Psg26 (574429)
Length:
1750
CDS:
206..1273

Additional Resources:

NCBI RefSeq record:
XM_006540238.3
NBCI Gene record:
Psg26 (574429)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540238.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217084 CACTGCATTCGCTGTACTATA pLKO.1 441 CDS 100% 13.200 9.240 N Psg26 n/a
2 TRCN0000197986 CCTCTCTTTGGCCTTCTAATT pLKO.1 1515 3UTR 100% 13.200 9.240 N Psg26 n/a
3 TRCN0000215802 CATTTATTGTCATGGCCAATT pLKO.1 1358 3UTR 100% 10.800 7.560 N Psg26 n/a
4 TRCN0000177815 CGGCAGAGAGACATTATACAT pLKO.1 490 CDS 100% 5.625 2.813 Y Psg26 n/a
5 TRCN0000065777 CCAAAGTATCTTCAATCACTT pLKO.1 740 CDS 100% 4.950 2.475 Y Psg28 n/a
6 TRCN0000176467 CCAAAGTATCTTCAATCACTT pLKO.1 740 CDS 100% 4.950 2.475 Y Psg26 n/a
7 TRCN0000065773 CCAGAGAATCTTCTAGTGTTT pLKO.1 380 CDS 100% 4.950 2.475 Y Psg28 n/a
8 TRCN0000177597 CCAGAGAATCTTCTAGTGTTT pLKO.1 380 CDS 100% 4.950 2.475 Y Psg26 n/a
9 TRCN0000065776 CCATAAGTAAACAAGGAGAAA pLKO.1 573 CDS 100% 4.950 2.475 Y Psg28 n/a
10 TRCN0000177386 GCTCTTCAACAATCAGAGTTT pLKO.1 1096 CDS 100% 4.950 2.475 Y Psg26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540238.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.