Transcript: Mouse XM_006540260.3

PREDICTED: Mus musculus zinc fingr protein 551 (Zfp551), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp551 (619331)
Length:
5059
CDS:
404..2218

Additional Resources:

NCBI RefSeq record:
XM_006540260.3
NBCI Gene record:
Zfp551 (619331)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540260.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229578 CCTCAAGAAAGGCCCTATAAA pLKO_005 1121 CDS 100% 15.000 21.000 N Zfp551 n/a
2 TRCN0000218473 ACAGTGCTAGAGTACATTATG pLKO_005 1203 CDS 100% 13.200 18.480 N Zfp551 n/a
3 TRCN0000229579 CGTAGGCAGAAAGTGCATAAA pLKO_005 2282 3UTR 100% 13.200 18.480 N Zfp551 n/a
4 TRCN0000229576 TATTCGTGAACAGCCTTATAG pLKO_005 820 CDS 100% 13.200 18.480 N Zfp551 n/a
5 TRCN0000229577 ACATTGTAAGGACGGTGAATG pLKO_005 880 CDS 100% 10.800 15.120 N Zfp551 n/a
6 TRCN0000255119 CTACAAATCTGAACTCGTTTA pLKO_005 1168 CDS 100% 10.800 15.120 N Zfp551 n/a
7 TRCN0000267568 CAGCAAACCCTTCACTCATAA pLKO_005 2077 CDS 100% 13.200 9.240 N Zfp551 n/a
8 TRCN0000255118 TGCTGCCTAGCGTGTTCTTTA pLKO_005 2241 3UTR 100% 13.200 9.240 N Zfp551 n/a
9 TRCN0000267537 ACCTTACGAGTGCCATGATTG pLKO_005 2140 CDS 100% 10.800 7.560 N Zfp551 n/a
10 TRCN0000255120 CACACTGGCACGAGACCTTAT pLKO_005 1790 CDS 100% 10.800 7.560 N Zfp551 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540260.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.