Transcript: Mouse XM_006540312.3

PREDICTED: Mus musculus zinc finger protein 787 (Zfp787), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Zfp787 (67109)
Length:
2222
CDS:
554..1606

Additional Resources:

NCBI RefSeq record:
XM_006540312.3
NBCI Gene record:
Zfp787 (67109)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540312.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000096198 CGGCGAAATCGCTATCCCAGT pLKO.1 1150 CDS 100% 0.720 1.008 N Zfp787 n/a
2 TRCN0000305285 GCTGCGGACAGAGTTTCTATC pLKO_005 1506 CDS 100% 10.800 7.560 N Zfp787 n/a
3 TRCN0000096194 CCAGAGAGAATCAGACCGAAA pLKO.1 1685 3UTR 100% 4.050 2.835 N Zfp787 n/a
4 TRCN0000349212 CCAGAGAGAATCAGACCGAAA pLKO_005 1685 3UTR 100% 4.050 2.835 N Zfp787 n/a
5 TRCN0000376144 ACAGAGCAAGAGCCTAGCCAA pLKO_005 940 CDS 100% 2.640 1.848 N Zfp787 n/a
6 TRCN0000305284 AGACACAAGAAGATCCATGCA pLKO_005 1460 CDS 100% 2.640 1.848 N Zfp787 n/a
7 TRCN0000376145 TCTCGCAGAGCTCGCATTTGG pLKO_005 768 CDS 100% 1.650 1.155 N Zfp787 n/a
8 TRCN0000096196 GCGCTCCCACAGTGGTTTAAA pLKO.1 967 CDS 100% 15.000 9.000 N Zfp787 n/a
9 TRCN0000351131 GCGCTCCCACAGTGGTTTAAA pLKO_005 967 CDS 100% 15.000 9.000 N Zfp787 n/a
10 TRCN0000376146 AGCCGTATGTGTGCATGGAGT pLKO_005 1293 CDS 100% 2.640 1.584 N Zfp787 n/a
11 TRCN0000107779 GCGCATCCACACGGGCGAGAA pLKO.1 883 CDS 100% 0.000 0.000 Y ZNF787 n/a
12 TRCN0000107776 GACATCCTCATCATGGATGAT pLKO.1 542 5UTR 100% 0.495 0.297 N ZNF787 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540312.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.