Transcript: Mouse XM_006540377.1

PREDICTED: Mus musculus smg-9 homolog, nonsense mediated mRNA decay factor (C. elegans) (Smg9), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Smg9 (71997)
Length:
2110
CDS:
149..1711

Additional Resources:

NCBI RefSeq record:
XM_006540377.1
NBCI Gene record:
Smg9 (71997)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540377.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265126 TGGATCAGACGGACGTGTTAG pLKO_005 744 CDS 100% 10.800 15.120 N Smg9 n/a
2 TRCN0000194319 CGGATTGTCTTCCTAGACACA pLKO.1 938 CDS 100% 0.264 0.370 N Smg9 n/a
3 TRCN0000265125 CAAACTGCCTCCAGAGTATAA pLKO_005 1009 CDS 100% 13.200 9.240 N Smg9 n/a
4 TRCN0000265127 TTGGACCACCTCATCAATAAC pLKO_005 983 CDS 100% 13.200 9.240 N Smg9 n/a
5 TRCN0000281647 CACAGCCTGTGTACCAGATTC pLKO_005 576 CDS 100% 10.800 7.560 N Smg9 n/a
6 TRCN0000175460 CCTTTCCCAAATCTCCATAGA pLKO.1 1939 3UTR 100% 4.950 3.465 N Smg9 n/a
7 TRCN0000281648 CTGCTCACAGGGTGACTAAGA pLKO_005 1890 3UTR 100% 4.950 3.465 N Smg9 n/a
8 TRCN0000194427 CATGCTACAGTGCAACGTCTT pLKO.1 1369 CDS 100% 4.050 2.835 N Smg9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540377.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.