Transcript: Mouse XM_006540581.3

PREDICTED: Mus musculus ATPase, class V, type 10A (Atp10a), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Atp10a (11982)
Length:
6171
CDS:
138..4664

Additional Resources:

NCBI RefSeq record:
XM_006540581.3
NBCI Gene record:
Atp10a (11982)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540581.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101497 CGCACCTATTGCTGCATTGTT pLKO.1 4019 CDS 100% 5.625 7.875 N Atp10a n/a
2 TRCN0000327352 CGCACCTATTGCTGCATTGTT pLKO_005 4019 CDS 100% 5.625 7.875 N Atp10a n/a
3 TRCN0000101495 CGGCACATTAACTGAGAACAA pLKO.1 1436 CDS 100% 4.950 6.930 N Atp10a n/a
4 TRCN0000327351 CGGCACATTAACTGAGAACAA pLKO_005 1436 CDS 100% 4.950 6.930 N Atp10a n/a
5 TRCN0000101496 CCTCGTTTGTATATCTCTATT pLKO.1 1097 CDS 100% 13.200 9.240 N Atp10a n/a
6 TRCN0000327425 CCTCGTTTGTATATCTCTATT pLKO_005 1097 CDS 100% 13.200 9.240 N Atp10a n/a
7 TRCN0000101499 AGTGGATACAAACATGCCATT pLKO.1 4310 CDS 100% 4.050 2.835 N Atp10a n/a
8 TRCN0000327426 AGTGGATACAAACATGCCATT pLKO_005 4310 CDS 100% 4.050 2.835 N Atp10a n/a
9 TRCN0000101498 GCCACAAATCTGGATCAGCTT pLKO.1 2050 CDS 100% 2.640 1.584 N Atp10a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540581.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.