Transcript: Mouse XM_006540717.1

PREDICTED: Mus musculus retinaldehyde binding protein 1 (Rlbp1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rlbp1 (19771)
Length:
2075
CDS:
427..1380

Additional Resources:

NCBI RefSeq record:
XM_006540717.1
NBCI Gene record:
Rlbp1 (19771)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540717.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427229 TGTAATCGCTTTGATACTTAG pLKO_005 1677 3UTR 100% 10.800 15.120 N Rlbp1 n/a
2 TRCN0000438556 TTCGATGTGGGTCGTGCTTAT pLKO_005 739 CDS 100% 10.800 15.120 N Rlbp1 n/a
3 TRCN0000105554 CAAGGATCATGGTCCTGTCTT pLKO.1 507 CDS 100% 4.950 6.930 N Rlbp1 n/a
4 TRCN0000105551 CGGCTTCTGTATTGTTGAGAA pLKO.1 1014 CDS 100% 4.950 3.960 N Rlbp1 n/a
5 TRCN0000105553 CACTGTGAAGAAGTGACCTTT pLKO.1 925 CDS 100% 4.950 3.465 N Rlbp1 n/a
6 TRCN0000105552 CACCACCTATAATGTGGTCAA pLKO.1 1170 CDS 100% 0.405 0.284 N Rlbp1 n/a
7 TRCN0000105550 GCAGTGACTCTGAGAGAAGTT pLKO.1 1617 3UTR 100% 4.950 2.970 N Rlbp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540717.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01402 pDONR223 100% 86.5% 90.5% None (many diffs) n/a
2 ccsbBroad304_01402 pLX_304 0% 86.5% 90.5% V5 (many diffs) n/a
Download CSV