Transcript: Mouse XM_006540743.3

PREDICTED: Mus musculus zinc finger protein 710 (Zfp710), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp710 (209225)
Length:
4766
CDS:
519..2519

Additional Resources:

NCBI RefSeq record:
XM_006540743.3
NBCI Gene record:
Zfp710 (209225)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540743.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095351 CCCTCTGAACTTGACAACCAT pLKO.1 2379 CDS 100% 3.000 4.200 N Zfp710 n/a
2 TRCN0000095353 GTCCTACACATCTAAGTATAA pLKO.1 1430 CDS 100% 13.200 9.240 N Zfp710 n/a
3 TRCN0000095352 GAAGTCCTACACATCTAAGTA pLKO.1 1427 CDS 100% 5.625 3.938 N Zfp710 n/a
4 TRCN0000095350 CCACATGCTCAAGCATCAGAA pLKO.1 1880 CDS 100% 4.950 3.465 N Zfp710 n/a
5 TRCN0000095349 CGTTTGAAAGAATGTCCCTAA pLKO.1 3176 3UTR 100% 4.050 2.835 N Zfp710 n/a
6 TRCN0000138949 GAAGTCCTTCAACCGCATGTA pLKO.1 2183 CDS 100% 4.950 2.970 N ZNF710 n/a
7 TRCN0000282020 GAAGTCCTTCAACCGCATGTA pLKO_005 2183 CDS 100% 4.950 2.970 N ZNF710 n/a
8 TRCN0000136453 CTCAAGACCCACATGATTGTA pLKO.1 2124 CDS 100% 5.625 3.938 N ZNF710 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540743.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.