Transcript: Mouse XM_006540842.3

PREDICTED: Mus musculus a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 17 (Adamts17), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Adamts17 (233332)
Length:
6212
CDS:
97..2916

Additional Resources:

NCBI RefSeq record:
XM_006540842.3
NBCI Gene record:
Adamts17 (233332)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540842.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000086773 CGCTGCAAAGTAGTGACAGAA pLKO.1 691 CDS 100% 4.950 3.960 N Adamts17 n/a
2 TRCN0000086776 GCTGTTATTTCATGACCAGAA pLKO.1 2469 CDS 100% 4.050 3.240 N Adamts17 n/a
3 TRCN0000086775 GCAGTGGTGGTTGATGATAAA pLKO.1 1963 CDS 100% 13.200 9.240 N Adamts17 n/a
4 TRCN0000086777 GAGCATCTGATCAGACGCAAA pLKO.1 622 CDS 100% 4.050 2.835 N Adamts17 n/a
5 TRCN0000086774 GCGTTCACAAAGATGAACCTT pLKO.1 1133 CDS 100% 0.300 0.210 N Adamts17 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3404 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540842.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.