Transcript: Mouse XM_006540864.3

PREDICTED: Mus musculus SH3/ankyrin domain gene 1 (Shank1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Shank1 (243961)
Length:
8337
CDS:
1232..7735

Additional Resources:

NCBI RefSeq record:
XM_006540864.3
NBCI Gene record:
Shank1 (243961)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540864.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219570 GCCGAGAGAAGAGCCTATATC pLKO.1 4200 CDS 100% 13.200 18.480 N Shank1 n/a
2 TRCN0000242045 AGTTCCTGGACCACGAGATTG pLKO_005 7602 CDS 100% 10.800 15.120 N Shank1 n/a
3 TRCN0000257109 CAAGTTTGACGTCGCTGATTG pLKO_005 7546 CDS 100% 10.800 15.120 N Shank1 n/a
4 TRCN0000219571 CTGACTTGCATCAGACGAAAT pLKO.1 1470 CDS 100% 10.800 15.120 N Shank1 n/a
5 TRCN0000219574 ACCGACCCAAAGGATTCTTTG pLKO.1 3804 CDS 100% 1.080 1.512 N Shank1 n/a
6 TRCN0000242046 ACATTGACCGGGCTCTCAAAT pLKO_005 7698 CDS 100% 13.200 9.240 N Shank1 n/a
7 TRCN0000219573 GCAGACGTAGGAAGCTCTATT pLKO.1 2865 CDS 100% 13.200 9.240 N Shank1 n/a
8 TRCN0000242047 GCATCCAGCCTGACCTCTTAT pLKO_005 6110 CDS 100% 13.200 9.240 N Shank1 n/a
9 TRCN0000219572 GCCTTATGCTCCGGCAGAAAT pLKO.1 3903 CDS 100% 13.200 9.240 N Shank1 n/a
10 TRCN0000242048 TCCCTACCATCATCATCAAAG pLKO_005 4716 CDS 100% 10.800 7.560 N Shank1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540864.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.