Transcript: Mouse XM_006541013.3

PREDICTED: Mus musculus sphingosine kinase 2 (Sphk2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sphk2 (56632)
Length:
2405
CDS:
88..1941

Additional Resources:

NCBI RefSeq record:
XM_006541013.3
NBCI Gene record:
Sphk2 (56632)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006541013.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000024631 GTTAGTGGAGTATGGGCCAAT pLKO.1 1851 CDS 100% 4.050 5.670 N Sphk2 n/a
2 TRCN0000024632 GCTCATATTGGTCAATCCCTT pLKO.1 531 CDS 100% 2.640 3.696 N Sphk2 n/a
3 TRCN0000297094 ACAAGCCTGAACGAGCCTAAA pLKO_005 1932 CDS 100% 10.800 8.640 N Sphk2 n/a
4 TRCN0000024633 CGGGCTGCACTTCTACGCATT pLKO.1 1708 CDS 100% 1.350 1.080 N Sphk2 n/a
5 TRCN0000274707 CGGGCTGCACTTCTACGCATT pLKO_005 1708 CDS 100% 1.350 1.080 N Sphk2 n/a
6 TRCN0000274708 ATAGGCTAAGATCTATCATTT pLKO_005 1983 3UTR 100% 13.200 9.240 N Sphk2 n/a
7 TRCN0000361748 GCAAGGCTTCTTCAGCTTATT pLKO_005 2147 3UTR 100% 13.200 9.240 N Sphk2 n/a
8 TRCN0000323489 CAACACAAGCCCTACACATAC pLKO_005 191 CDS 100% 10.800 7.560 N Sphk2 n/a
9 TRCN0000274706 CCCAAGACTGGGTGACAATAG pLKO_005 1562 CDS 100% 10.800 7.560 N Sphk2 n/a
10 TRCN0000361749 GGCTGCTCATATTGGTCAATC pLKO_005 527 CDS 100% 10.800 7.560 N Sphk2 n/a
11 TRCN0000024629 GCCACCACTTATGAGGAGAAT pLKO.1 400 CDS 100% 4.950 3.465 N Sphk2 n/a
12 TRCN0000036973 CTACTTCTGCATCTACACCTA pLKO.1 321 CDS 100% 2.640 1.848 N SPHK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006541013.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.