Transcript: Mouse XM_006541028.3

PREDICTED: Mus musculus interferon-stimulated protein (Isg20), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Isg20 (57444)
Length:
1407
CDS:
294..1196

Additional Resources:

NCBI RefSeq record:
XM_006541028.3
NBCI Gene record:
Isg20 (57444)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006541028.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218576 AGTCCTGTATGACAAGTACAT pLKO_005 401 CDS 100% 4.950 6.930 N Isg20 n/a
2 TRCN0000374865 AGACCTGTTTCTAACAACCAC pLKO_005 1228 3UTR 100% 2.640 3.696 N Isg20 n/a
3 TRCN0000120751 GACCTGAAGCACGACTTCAAT pLKO.1 561 CDS 100% 0.563 0.450 N Isg20 n/a
4 TRCN0000350156 GACCTGAAGCACGACTTCAAT pLKO_005 561 CDS 100% 0.563 0.450 N Isg20 n/a
5 TRCN0000120747 CTCCTCAAGTTCTCCATGAAT pLKO.1 1206 3UTR 100% 5.625 3.938 N Isg20 n/a
6 TRCN0000238033 AGGCCAAGCTGCAGTACTACA pLKO_005 649 CDS 100% 4.950 3.465 N Isg20 n/a
7 TRCN0000238034 AGGGAGAGATCACGGACTACA pLKO_005 430 CDS 100% 4.950 3.465 N Isg20 n/a
8 TRCN0000238035 ATCCTCATCCAGGGTTAGAAG pLKO_005 1179 CDS 100% 4.950 3.465 N Isg20 n/a
9 TRCN0000257364 CCGCTGCAGCATTGTGAACAT pLKO_005 371 CDS 100% 4.950 3.465 N Isg20 n/a
10 TRCN0000120750 GAAGGAGGATATGAGCAAGTA pLKO.1 587 CDS 100% 4.950 3.465 N Isg20 n/a
11 TRCN0000374798 TGGTGAAGCCAGGCTAGAGAT pLKO_005 503 CDS 100% 4.950 3.465 N Isg20 n/a
12 TRCN0000120748 GCTACACAAGAACATCCAGAA pLKO.1 704 CDS 100% 4.050 2.835 N Isg20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006541028.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.