Transcript: Mouse XM_006541218.3

PREDICTED: Mus musculus lines homolog 1 (Lins1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lins1 (72635)
Length:
3533
CDS:
336..2615

Additional Resources:

NCBI RefSeq record:
XM_006541218.3
NBCI Gene record:
Lins1 (72635)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006541218.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246827 CCGAGCTACTGGCCTTCTTAA pLKO_005 1612 CDS 100% 13.200 18.480 N Lins1 n/a
2 TRCN0000257551 GAAACCACAAGTGAGCATTTA pLKO_005 2277 CDS 100% 13.200 18.480 N Lins1 n/a
3 TRCN0000190322 CCACAAGTGAGCATTTAGCAA pLKO.1 2281 CDS 100% 3.000 4.200 N Lins1 n/a
4 TRCN0000246824 ACCGCAGAGTCTGGTAGATTA pLKO_005 2231 CDS 100% 13.200 10.560 N Lins1 n/a
5 TRCN0000246826 CCTGAGAGCAGCAAGCTTAAT pLKO_005 1511 CDS 100% 13.200 9.240 N Lins1 n/a
6 TRCN0000246825 GAGACCTGTTTCCTTGAATAT pLKO_005 1917 CDS 100% 13.200 9.240 N Lins1 n/a
7 TRCN0000216814 GATATTCTTGCCTGGCCTATT pLKO.1 1221 CDS 100% 10.800 7.560 N Lins1 n/a
8 TRCN0000217333 GACAGTGACATGCTCACTTTA pLKO.1 1359 CDS 100% 1.320 0.924 N Lins1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006541218.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.